Review



negative control, scrambled sgrna#1, mod-sgrna  (Synthego Inc)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90

    Structured Review

    Synthego Inc negative control, scrambled sgrna#1, mod-sgrna
    Negative Control, Scrambled Sgrna#1, Mod Sgrna, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/negative control, scrambled sgrna#1, mod-sgrna/product/Synthego Inc
    Average 90 stars, based on 1 article reviews
    negative control, scrambled sgrna#1, mod-sgrna - by Bioz Stars, 2026-03
    90/100 stars

    Images



    Similar Products

    90
    Synthego Inc negative control, scrambled sgrna#1, mod-sgrna
    Negative Control, Scrambled Sgrna#1, Mod Sgrna, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/negative control, scrambled sgrna#1, mod-sgrna/product/Synthego Inc
    Average 90 stars, based on 1 article reviews
    negative control, scrambled sgrna#1, mod-sgrna - by Bioz Stars, 2026-03
    90/100 stars
      Buy from Supplier

    90
    Synthego Inc negative control scrambled sgrna (modified) #1
    Negative Control Scrambled Sgrna (Modified) #1, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/negative control scrambled sgrna (modified) #1/product/Synthego Inc
    Average 90 stars, based on 1 article reviews
    negative control scrambled sgrna (modified) #1 - by Bioz Stars, 2026-03
    90/100 stars
      Buy from Supplier

    90
    Thermo Fisher scrambled negative control sgrna cat#a35526
    Scrambled Negative Control Sgrna Cat#A35526, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/scrambled negative control sgrna cat#a35526/product/Thermo Fisher
    Average 90 stars, based on 1 article reviews
    scrambled negative control sgrna cat#a35526 - by Bioz Stars, 2026-03
    90/100 stars
      Buy from Supplier

    90
    Synthego Inc negative control scrambled sgrna
    Negative Control Scrambled Sgrna, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/negative control scrambled sgrna/product/Synthego Inc
    Average 90 stars, based on 1 article reviews
    negative control scrambled sgrna - by Bioz Stars, 2026-03
    90/100 stars
      Buy from Supplier

    90
    Synthego Inc non-targeting sgrnas negative control scrambling sgrna #1 and #2
    Non Targeting Sgrnas Negative Control Scrambling Sgrna #1 And #2, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/non-targeting sgrnas negative control scrambling sgrna #1 and #2/product/Synthego Inc
    Average 90 stars, based on 1 article reviews
    non-targeting sgrnas negative control scrambling sgrna #1 and #2 - by Bioz Stars, 2026-03
    90/100 stars
      Buy from Supplier

    90
    Synthego Inc negative control scrambled sgrna#1
    Negative Control Scrambled Sgrna#1, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/negative control scrambled sgrna#1/product/Synthego Inc
    Average 90 stars, based on 1 article reviews
    negative control scrambled sgrna#1 - by Bioz Stars, 2026-03
    90/100 stars
      Buy from Supplier

    90
    Synthego Inc negative control scrambled sgrna (variable sequence: gcacuaccagagcuaacuca)
    Negative Control Scrambled Sgrna (Variable Sequence: Gcacuaccagagcuaacuca), supplied by Synthego Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/negative control scrambled sgrna (variable sequence: gcacuaccagagcuaacuca)/product/Synthego Inc
    Average 90 stars, based on 1 article reviews
    negative control scrambled sgrna (variable sequence: gcacuaccagagcuaacuca) - by Bioz Stars, 2026-03
    90/100 stars
      Buy from Supplier

    Image Search Results