Review



negative control, scrambled sgrna#1, mod-sgrna  (Synthego Inc)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 90
      Buy from Supplier

    Structured Review

    Synthego Inc negative control, scrambled sgrna#1, mod-sgrna
    Negative Control, Scrambled Sgrna#1, Mod Sgrna, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/negative control, scrambled sgrna#1, mod-sgrna/product/Synthego Inc
    Average 90 stars, based on 1 article reviews
    negative control, scrambled sgrna#1, mod-sgrna - by Bioz Stars, 2026-03
    90/100 stars

    Images



    Similar Products

    negative control, scrambled sgrna#1, mod-sgrna  (Synthego Inc)
    90
    Synthego Inc negative control, scrambled sgrna#1, mod-sgrna
    Negative Control, Scrambled Sgrna#1, Mod Sgrna, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/negative control, scrambled sgrna#1, mod-sgrna/product/Synthego Inc
    Average 90 stars, based on 1 article reviews
    negative control, scrambled sgrna#1, mod-sgrna - by Bioz Stars, 2026-03
    90/100 stars
    		  Buy from Supplier
    negative control scrambled sgrna (modified) #1  (Synthego Inc)
    90
    Synthego Inc negative control scrambled sgrna (modified) #1
    Negative Control Scrambled Sgrna (Modified) #1, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/negative control scrambled sgrna (modified) #1/product/Synthego Inc
    Average 90 stars, based on 1 article reviews
    negative control scrambled sgrna (modified) #1 - by Bioz Stars, 2026-03
    90/100 stars
    		  Buy from Supplier
    scrambled negative control sgrna cat#a35526  (Thermo Fisher)
    90
    Thermo Fisher scrambled negative control sgrna cat#a35526
    Scrambled Negative Control Sgrna Cat#A35526, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/scrambled negative control sgrna cat#a35526/product/Thermo Fisher
    Average 90 stars, based on 1 article reviews
    scrambled negative control sgrna cat#a35526 - by Bioz Stars, 2026-03
    90/100 stars
    		  Buy from Supplier
    negative control scrambled sgrna  (Synthego Inc)
    90
    Synthego Inc negative control scrambled sgrna
    Negative Control Scrambled Sgrna, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/negative control scrambled sgrna/product/Synthego Inc
    Average 90 stars, based on 1 article reviews
    negative control scrambled sgrna - by Bioz Stars, 2026-03
    90/100 stars
    		  Buy from Supplier
    non-targeting sgrnas negative control scrambling sgrna #1 and #2  (Synthego Inc)
    90
    Synthego Inc non-targeting sgrnas negative control scrambling sgrna #1 and #2
    Non Targeting Sgrnas Negative Control Scrambling Sgrna #1 And #2, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/non-targeting sgrnas negative control scrambling sgrna #1 and #2/product/Synthego Inc
    Average 90 stars, based on 1 article reviews
    non-targeting sgrnas negative control scrambling sgrna #1 and #2 - by Bioz Stars, 2026-03
    90/100 stars
    		  Buy from Supplier
    negative control scrambled sgrna#1  (Synthego Inc)
    90
    Synthego Inc negative control scrambled sgrna#1
    Negative Control Scrambled Sgrna#1, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/negative control scrambled sgrna#1/product/Synthego Inc
    Average 90 stars, based on 1 article reviews
    negative control scrambled sgrna#1 - by Bioz Stars, 2026-03
    90/100 stars
    		  Buy from Supplier
    negative control scrambled sgrna (variable sequence: gcacuaccagagcuaacuca)  (Synthego Inc)
    90
    Synthego Inc negative control scrambled sgrna (variable sequence: gcacuaccagagcuaacuca)
    Negative Control Scrambled Sgrna (Variable Sequence: Gcacuaccagagcuaacuca), supplied by Synthego Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/result/negative control scrambled sgrna (variable sequence: gcacuaccagagcuaacuca)/product/Synthego Inc
    Average 90 stars, based on 1 article reviews
    negative control scrambled sgrna (variable sequence: gcacuaccagagcuaacuca) - by Bioz Stars, 2026-03
    90/100 stars
    		  Buy from Supplier

    Image Search Results